miR853
DB statistics:
  • Sunday, April 5th 2020:
  • 114 miRNA familiesNews divider
  • 190 pre-miRNA sequencesNews divider
  • 7 developmental stages News divider
  • 190 hairpin structures
Expression
Switch to: Actin

In most cases the level of expression of pre-miRNA is lower than reference genes. To avoid showing the expression level as a negative value, the graph below is rescaled and the zero value on the y-axis corresponds to minimal expression level in the whole experiment (-7).

The expression values are rescaled. Read more

Expression Data

Download CSV Table

Expression Data
Development stageactinPP2A
LogSDLogSD
seed4.460310.7239114.532820.663175
10day-seedling2.777220.251524.585370.197372
14day-seedling1.732070.7340212.904821.45628
25day-aerial2.332050.04822784.094140.109237
35day-aerial2.938470.1542084.731490.0603602
42day-rosette2.567180.2919544.640360.364559
42day-stem2.355290.3414424.374540.102617
53day-rosette3.619920.7008545.462430.669758
53day-stem5.553363.674426.97091044.15262
53day-inflores3.083050.04275024.517180.0849875
53day-silique3.024190.9182974.166780.953293
Raw Expression Data

Download CSV Table

Raw Data
Development stagerepR2CtactinPP2A
ΔCt2^(-ΔCt)log10ΔCt2^(-ΔCt)log10
seed11.00034.1910.337.77e-4-3.1110.248.25e-4-3.08
21.00033.715.731.88e-2-1.735.861.72e-2-1.77
31.00033.529.251.64e-3-2.788.482.80e-3-2.55
10day-seedling11.00025.9313.071.17e-4-3.937.575.25e-3-2.28
21.00027.8314.594.06e-5-4.398.772.28e-3-2.64
31.00025.814.434.53e-5-4.347.724.75e-3-2.32
14day-seedling11.00028.3814.813.48e-5-4.468.163.49e-3-2.46
20.00036.2418.133.49e-6-5.4615.222.62e-5-4.58
31.00037.3519.561.29e-6-5.8917.425.69e-6-5.25
25day-aerial10.99628.5415.681.91e-5-4.729.921.03e-3-2.99
20.98429.5215.482.19e-5-4.669.241.66e-3-2.78
31.00029.2415.362.37e-5-4.629.81.12e-3-2.95
35day-aerial10.99827.3712.921.29e-4-3.897.386.01e-3-2.22
21.00026.6213.896.57e-5-4.187.764.61e-3-2.34
30.00026.8513.657.76e-5-4.117.475.65e-3-2.25
42day-rosette10.99927.0813.548.38e-5-4.086.441.15e-2-1.94
20.99828.6314.245.16e-5-4.298.552.66e-3-2.57
31.00027.6114.095.73e-5-4.248.522.72e-3-2.57
42day-stem10.99925.3113.627.94e-1-58.43.15e-1-2.51
20.99726.8614.324.89e-1-4.328.772.29e-1-2.64
31.00028.7215.332.42e-1-4.629.261.92e-1-2.72
53day-rosette11.00022.68.552.67e-3-2.572.561.70e-1-0.77
21.00024.6712.381.87e-4-3.736.679.85e-3-2.01
31.00025.6512.751.45e-4-3.846.11.46e-2-1.84
53day-stem10.8374.13-9.296.25e+22.8-15.815.73e+44.76
21.00026.7111.932.55e-4-3.597.286.43e-3-2.19
31.00029.3711.772.86e-4-3.548.822.22e-3-2.65
53day-inflores10.99326.4913.091.14e-4-3.947.944.07e-3-2.39
21.00027.4812.851.36e-4-3.878.293.19e-3-2.5
31.00026.9213.091.14e-4-3.948.52.76e-3-2.56
53day-silique11.00030.2410.397.45e-4-3.136.441.15e-2-1.94
21.00035.7416.451.12e-5-4.9512.741.46e-4-3.84
31.00031.7512.781.42e-4-3.859.051.88e-3-2.72
NGS expression data
Expression of miR853 transcript in NGS data
Sequences
miRNA transcript
GAGAGGAACAAUUAGGGUUGUUUCAAACAGGGUAAAGUGUUCCUGCUGCUCCCCUCUUUAGCUUGGAGAAGCCAGUAAAUAUCUUUCUCUUCAAGGAACUUGUGGGCCUCAAGAAAACCUGCUAUAAUUCUAGUUUUUCAACAUUCCUCCUUCUGAUAUCAGCAACAACUCCUUACCCUUAAGAAUGGAGAAUGGAACUUCCUCAAAGAUAUUUACUUGGCCUCUGCAACCGGAAAGGGGAGCAGCAUGAAACUCUUUUAACCCUUACCCUGUAUUUGUCAAAAACAGAU
Short sequences
sequencetypearmstartend
UCCCCUCUUUAGCUUGGAGAAG
miRNA5071
TTCCTGCTGCTCCCCTCTTTA
primer5p4060
CGGTTGCAGAGGCCAAGTAAAT
primer3p211232

For experimental procedure see:Materials and Methods


Cross-references
miRBasemiRBase record
ASRPASRP record
PMRDPMRD record
TAIRTAIR record
PubMed EntrezThe most up-to-date article(s) about miR853 found in PubMed

STRUCTURE

miRNA
miRNA*
primer 5p
primer 3p
sRNA

Length = 290 nt
MFE = -94.30 kcal/mol

COMMENTS