UUAGAAUAUGUUUUUCCUAAU
| Count | Sample ID | Experiment title |
|---|---|---|
| 66 | GSM707685 | Characterization of AGO1-/AGO4-associated smRNAs |
| 56 | GSM707683 | Characterization of AGO1-/AGO4-associated smRNAs |
| 29 | GSM707679 | Characterization of AGO1-/AGO4-associated smRNAs |
| 15 | GSM707681 | Characterization of AGO1-/AGO4-associated smRNAs |
| 4 | GSM366866 | Computational and Analytical Framework for Small RNA Profiling by High-Throughput Sequencing (reproducibility) |
| 3 | GSM707678 | Characterization of AGO1-/AGO4-associated smRNAs |
| 2 | GSM707689 | Characterization of AGO1-/AGO4-associated smRNAs |
| 2 | GSM707690 | Characterization of AGO1-/AGO4-associated smRNAs |
| 1 | GSM149079 | Small RNAs in Arabidopsis thaliana and its RISC complexes |
| 1 | GSM149080 | Small RNAs in Arabidopsis thaliana and its RISC complexes |
| 1 | GSM442935 | Uncovering small RNA-mediated responses to phosphate-deficiency in Arabidopsis by deep sequencing |
| 1 | GSM506691 | Accumulation of TuMV-derived siRNAs in aerial parts of Arabidopsis thaliana plants at 7 and 10 dpi |
| 1 | GSM707687 | Characterization of AGO1-/AGO4-associated smRNAs |
| 1 | GSM707691 | Characterization of AGO1-/AGO4-associated smRNAs |