UGUUGAUCUCAAUAGCAUUGA
| Count | Sample ID | Experiment title |
|---|---|---|
| 6 | GSM707685 | Characterization of AGO1-/AGO4-associated smRNAs |
| 4 | GSM506689 | Accumulation of TuMV-derived siRNAs in aerial parts of Arabidopsis thaliana plants at 7 and 10 dpi |
| 4 | GSM707679 | Characterization of AGO1-/AGO4-associated smRNAs |
| 2 | GSM442935 | Uncovering small RNA-mediated responses to phosphate-deficiency in Arabidopsis by deep sequencing |
| 2 | GSM707681 | Characterization of AGO1-/AGO4-associated smRNAs |
| 1 | GSM366867 | Computational and Analytical Framework for Small RNA Profiling by High-Throughput Sequencing (reproducibility) |
| 1 | GSM442933 | Uncovering small RNA-mediated responses to phosphate-deficiency in Arabidopsis by deep sequencing |
| 1 | GSM491572 | Genome-wide analysis of siRNA accumulation in Arabidopsis treated with bacteria |
| 1 | GSM512703 | Genome-wide maps of AGO1-bound small RNA in Arabidopsis leaves |
| 1 | GSM707678 | Characterization of AGO1-/AGO4-associated smRNAs |
| 1 | GSM707689 | Characterization of AGO1-/AGO4-associated smRNAs |
| 1 | GSM707691 | Characterization of AGO1-/AGO4-associated smRNAs |