UGAAACAUAAUCUAGGUUGUA
| Count | Sample ID | Experiment title |
|---|---|---|
| 4 | GSM707679 | Characterization of AGO1-/AGO4-associated smRNAs |
| 2 | GSM149080 | Small RNAs in Arabidopsis thaliana and its RISC complexes |
| 2 | GSM491574 | Genome-wide analysis of siRNA accumulation in Arabidopsis treated with bacteria |
| 2 | GSM707683 | Characterization of AGO1-/AGO4-associated smRNAs |
| 2 | GSM707687 | Characterization of AGO1-/AGO4-associated smRNAs |
| 1 | GSM342999 | AGO1-dependent Small RNA in Arabidopsis Identified by High-Throughput Sequencing |
| 1 | GSM387513 | Small RNAs serve as a genetic buffer against genomic shock in Arabidopsis interspecific hybrids and allopolyploids |
| 1 | GSM491567 | Genome-wide analysis of siRNA accumulation in Arabidopsis treated with bacteria |
| 1 | GSM491576 | Genome-wide analysis of siRNA accumulation in Arabidopsis treated with bacteria |
| 1 | GSM491578 | Genome-wide analysis of siRNA accumulation in Arabidopsis treated with bacteria |
| 1 | GSM512702 | Genome-wide maps of AGO1-bound small RNA in Arabidopsis leaves |
| 1 | GSM518447 | small RNAs sequences from grafted Arabidopsis thaliana and Nicotiana benthamiana tissues |