UCUUGUUGAUCUCAAUAGCAUU
| Count | Sample ID | Experiment title |
|---|---|---|
| 7 | GSM707679 | Characterization of AGO1-/AGO4-associated smRNAs |
| 2 | GSM491569 | Genome-wide analysis of siRNA accumulation in Arabidopsis treated with bacteria |
| 1 | GSM442934 | Uncovering small RNA-mediated responses to phosphate-deficiency in Arabidopsis by deep sequencing |
| 1 | GSM442935 | Uncovering small RNA-mediated responses to phosphate-deficiency in Arabidopsis by deep sequencing |
| 1 | GSM491571 | Genome-wide analysis of siRNA accumulation in Arabidopsis treated with bacteria |
| 1 | GSM707681 | Characterization of AGO1-/AGO4-associated smRNAs |
| 1 | GSM707685 | Characterization of AGO1-/AGO4-associated smRNAs |
| 1 | GSM707690 | Characterization of AGO1-/AGO4-associated smRNAs |