UAUGUCUUGUUGAUCUCAAUAGCA
Count | Sample ID | Experiment title |
---|---|---|
27 | GSM707689 | Characterization of AGO1-/AGO4-associated smRNAs |
3 | GSM707687 | Characterization of AGO1-/AGO4-associated smRNAs |
2 | GSM491574 | Genome-wide analysis of siRNA accumulation in Arabidopsis treated with bacteria |
2 | GSM707681 | Characterization of AGO1-/AGO4-associated smRNAs |
2 | GSM707685 | Characterization of AGO1-/AGO4-associated smRNAs |
1 | GSM491577 | Genome-wide analysis of siRNA accumulation in Arabidopsis treated with bacteria |
1 | GSM707679 | Characterization of AGO1-/AGO4-associated smRNAs |