AUGCAAUUUAGAAUAUGUUUUUCC
| Count | Sample ID | Experiment title |
|---|---|---|
| 18 | GSM707687 | Characterization of AGO1-/AGO4-associated smRNAs |
| 9 | GSM707679 | Characterization of AGO1-/AGO4-associated smRNAs |
| 1 | GSM118375 | High-throughput sequencing of small RNAs from Arabidopsis thaliana |
| 1 | GSM575246 | Genome-wide double-stranded RNA sequencing reveals the functional significance of base-paired RNAs in Arabidopsis |
| 1 | GSM707681 | Characterization of AGO1-/AGO4-associated smRNAs |
| 1 | GSM711893 | Small RNA sequencing in nine-day old nutrient-replete and N or P-limited wild type Arabidopsis seedlings |