AGGUGAAACAUAAUCUAGGUUGUA
| Count | Sample ID | Experiment title |
|---|---|---|
| 22 | GSM707689 | Characterization of AGO1-/AGO4-associated smRNAs |
| 5 | GSM253624 | Small RNAs in four Argonaute complexes in Arabidopsis |
| 4 | GSM707687 | Characterization of AGO1-/AGO4-associated smRNAs |
| 2 | GSM118374 | High-throughput sequencing of small RNAs from Arabidopsis thaliana |
| 2 | GSM707679 | Characterization of AGO1-/AGO4-associated smRNAs |
| 1 | GSM491573 | Genome-wide analysis of siRNA accumulation in Arabidopsis treated with bacteria |
| 1 | GSM491576 | Genome-wide analysis of siRNA accumulation in Arabidopsis treated with bacteria |
| 1 | GSM506669 | Accumulation of TuMV-derived siRNAs in aerial parts of Arabidopsis thaliana plants at 7 and 10 dpi |
| 1 | GSM518446 | small RNAs sequences from grafted Arabidopsis thaliana and Nicotiana benthamiana tissues |
| 1 | GSM518447 | small RNAs sequences from grafted Arabidopsis thaliana and Nicotiana benthamiana tissues |
| 1 | GSM518467 | small RNAs sequences from grafted Arabidopsis thaliana and Nicotiana benthamiana tissues |
| 1 | GSM707683 | Characterization of AGO1-/AGO4-associated smRNAs |
| 1 | GSM707685 | Characterization of AGO1-/AGO4-associated smRNAs |
| 1 | GSM707686 | Characterization of AGO1-/AGO4-associated smRNAs |
| 1 | GSM707688 | Characterization of AGO1-/AGO4-associated smRNAs |