Sequence

AAUAUGUUUUUCCUAAUUUGA

Expression details
CountSample IDExperiment title
3GSM506689Accumulation of TuMV-derived siRNAs in aerial parts of Arabidopsis thaliana plants at 7 and 10 dpi
2GSM707679Characterization of AGO1-/AGO4-associated smRNAs
1GSM506674Accumulation of TuMV-derived siRNAs in aerial parts of Arabidopsis thaliana plants at 7 and 10 dpi
1GSM506681Accumulation of TuMV-derived siRNAs in aerial parts of Arabidopsis thaliana plants at 7 and 10 dpi
1GSM707681Characterization of AGO1-/AGO4-associated smRNAs