UCAAUAGAUUGGACUAUGUA
| Count | Sample ID | Experiment title |
|---|---|---|
| 40 | GSM707681 | Characterization of AGO1-/AGO4-associated smRNAs |
| 39 | GSM707678 | Characterization of AGO1-/AGO4-associated smRNAs |
| 32 | GSM707685 | Characterization of AGO1-/AGO4-associated smRNAs |
| 31 | GSM707682 | Characterization of AGO1-/AGO4-associated smRNAs |
| 27 | GSM707690 | Characterization of AGO1-/AGO4-associated smRNAs |
| 27 | GSM707691 | Characterization of AGO1-/AGO4-associated smRNAs |
| 16 | GSM707679 | Characterization of AGO1-/AGO4-associated smRNAs |
| 16 | GSM707680 | Characterization of AGO1-/AGO4-associated smRNAs |
| 10 | GSM707689 | Characterization of AGO1-/AGO4-associated smRNAs |
| 8 | GSM707683 | Characterization of AGO1-/AGO4-associated smRNAs |
| 8 | GSM707684 | Characterization of AGO1-/AGO4-associated smRNAs |
| 4 | GSM277608 | Highly integrated single base resolution maps of the epigenome in Arabidopsis |
| 4 | GSM343004 | AGO1-dependent Small RNA in Arabidopsis Identified by High-Throughput Sequencing |
| 4 | GSM442933 | Uncovering small RNA-mediated responses to phosphate-deficiency in Arabidopsis by deep sequencing |
| 4 | GSM575246 | Genome-wide double-stranded RNA sequencing reveals the functional significance of base-paired RNAs in Arabidopsis |
| 3 | GSM575247 | Genome-wide double-stranded RNA sequencing reveals the functional significance of base-paired RNAs in Arabidopsis |
| 2 | GSM253622 | Small RNAs in four Argonaute complexes in Arabidopsis |
| 2 | GSM343001 | AGO1-dependent Small RNA in Arabidopsis Identified by High-Throughput Sequencing |
| 2 | GSM442932 | Uncovering small RNA-mediated responses to phosphate-deficiency in Arabidopsis by deep sequencing |
| 2 | GSM506664 | Accumulation of TuMV-derived siRNAs in aerial parts of Arabidopsis thaliana plants at 7 and 10 dpi |
| 2 | GSM506683 | Accumulation of TuMV-derived siRNAs in aerial parts of Arabidopsis thaliana plants at 7 and 10 dpi |
| 1 | GSM277609 | Highly integrated single base resolution maps of the epigenome in Arabidopsis |
| 1 | GSM277611 | Highly integrated single base resolution maps of the epigenome in Arabidopsis |
| 1 | GSM284747 | A link between RNA metabolism and silencing affecting Arabidopsis development |
| 1 | GSM284748 | A link between RNA metabolism and silencing affecting Arabidopsis development |
| 1 | GSM284750 | A link between RNA metabolism and silencing affecting Arabidopsis development |
| 1 | GSM343005 | AGO1-dependent Small RNA in Arabidopsis Identified by High-Throughput Sequencing |
| 1 | GSM491578 | Genome-wide analysis of siRNA accumulation in Arabidopsis treated with bacteria |
| 1 | GSM506684 | Accumulation of TuMV-derived siRNAs in aerial parts of Arabidopsis thaliana plants at 7 and 10 dpi |
| 1 | GSM506689 | Accumulation of TuMV-derived siRNAs in aerial parts of Arabidopsis thaliana plants at 7 and 10 dpi |