GAUUGGACUAUGUAUAUUAA
Count | Sample ID | Experiment title |
---|---|---|
2 | GSM253623 | Small RNAs in four Argonaute complexes in Arabidopsis |
1 | GSM154363 | Arabidopsis thaliana small RNAs sequences identified using high-throughput 454 sequencing technology |
1 | GSM154364 | Arabidopsis thaliana small RNAs sequences identified using high-throughput 454 sequencing technology |
1 | GSM154365 | Arabidopsis thaliana small RNAs sequences identified using high-throughput 454 sequencing technology |
1 | GSM154367 | Arabidopsis thaliana small RNAs sequences identified using high-throughput 454 sequencing technology |
1 | GSM154368 | Arabidopsis thaliana small RNAs sequences identified using high-throughput 454 sequencing technology |
1 | GSM154377 | Arabidopsis thaliana small RNAs sequences identified using high-throughput 454 sequencing technology |
1 | GSM284748 | A link between RNA metabolism and silencing affecting Arabidopsis development |
1 | GSM491578 | Genome-wide analysis of siRNA accumulation in Arabidopsis treated with bacteria |