CAAUAGAUUGGACUAUGUAU
| Count | Sample ID | Experiment title |
|---|---|---|
| 3 | GSM707690 | Characterization of AGO1-/AGO4-associated smRNAs |
| 1 | GSM277608 | Highly integrated single base resolution maps of the epigenome in Arabidopsis |
| 1 | GSM575247 | Genome-wide double-stranded RNA sequencing reveals the functional significance of base-paired RNAs in Arabidopsis |
| 1 | GSM707684 | Characterization of AGO1-/AGO4-associated smRNAs |
| 1 | GSM707685 | Characterization of AGO1-/AGO4-associated smRNAs |