AAUAGAUUGGACUAUGUAUAUUAA
| Count | Sample ID | Experiment title |
|---|---|---|
| 1 | GSM284748 | A link between RNA metabolism and silencing affecting Arabidopsis development |
| 1 | GSM491578 | Genome-wide analysis of siRNA accumulation in Arabidopsis treated with bacteria |
| 1 | GSM491579 | Genome-wide analysis of siRNA accumulation in Arabidopsis treated with bacteria |
| 1 | GSM575246 | Genome-wide double-stranded RNA sequencing reveals the functional significance of base-paired RNAs in Arabidopsis |