UUAGUUGUCGUCGUAUCUUUG
| Count | Sample ID | Experiment title |
|---|---|---|
| 42 | GSM442935 | Uncovering small RNA-mediated responses to phosphate-deficiency in Arabidopsis by deep sequencing |
| 29 | GSM442934 | Uncovering small RNA-mediated responses to phosphate-deficiency in Arabidopsis by deep sequencing |
| 29 | GSM707685 | Characterization of AGO1-/AGO4-associated smRNAs |
| 23 | GSM707683 | Characterization of AGO1-/AGO4-associated smRNAs |
| 22 | GSM366866 | Computational and Analytical Framework for Small RNA Profiling by High-Throughput Sequencing (reproducibility) |
| 17 | GSM707681 | Characterization of AGO1-/AGO4-associated smRNAs |
| 13 | GSM518432 | MIRNA Gene Evolution in Arabidopsis lyrata and Arabidopsis thaliana |
| 11 | GSM711893 | Small RNA sequencing in nine-day old nutrient-replete and N or P-limited wild type Arabidopsis seedlings |
| 10 | GSM711892 | Small RNA sequencing in nine-day old nutrient-replete and N or P-limited wild type Arabidopsis seedlings |
| 9 | GSM366865 | Computational and Analytical Framework for Small RNA Profiling by High-Throughput Sequencing (reproducibility) |
| 8 | GSM491579 | Genome-wide analysis of siRNA accumulation in Arabidopsis treated with bacteria |
| 7 | GSM149080 | Small RNAs in Arabidopsis thaliana and its RISC complexes |
| 7 | GSM366867 | Computational and Analytical Framework for Small RNA Profiling by High-Throughput Sequencing (reproducibility) |
| 7 | GSM605665 | Homology-guided Assembly of the Genomes of the Four Diverse Accessions Ler, C24, Bur-0 and Kro-0 |
| 6 | GSM491571 | Genome-wide analysis of siRNA accumulation in Arabidopsis treated with bacteria |
| 6 | GSM707679 | Characterization of AGO1-/AGO4-associated smRNAs |
| 5 | GSM491574 | Genome-wide analysis of siRNA accumulation in Arabidopsis treated with bacteria |
| 5 | GSM491577 | Genome-wide analysis of siRNA accumulation in Arabidopsis treated with bacteria |
| 5 | GSM491578 | Genome-wide analysis of siRNA accumulation in Arabidopsis treated with bacteria |
| 5 | GSM711894 | Small RNA sequencing in nine-day old nutrient-replete and N or P-limited wild type Arabidopsis seedlings |
| 5 | GSM711895 | Small RNA sequencing in nine-day old nutrient-replete and N or P-limited wild type Arabidopsis seedlings |
| 4 | GSM491568 | Genome-wide analysis of siRNA accumulation in Arabidopsis treated with bacteria |
| 4 | GSM491572 | Genome-wide analysis of siRNA accumulation in Arabidopsis treated with bacteria |
| 4 | GSM491576 | Genome-wide analysis of siRNA accumulation in Arabidopsis treated with bacteria |
| 4 | GSM605664 | Homology-guided Assembly of the Genomes of the Four Diverse Accessions Ler, C24, Bur-0 and Kro-0 |
| 4 | GSM711891 | Small RNA sequencing in nine-day old nutrient-replete and N or P-limited wild type Arabidopsis seedlings |
| 3 | GSM424742 | smRNAs in wildtype and RDR6-15 knockout Arabidopsis thaliana Col-0 leaf |
| 3 | GSM491567 | Genome-wide analysis of siRNA accumulation in Arabidopsis treated with bacteria |
| 3 | GSM491575 | Genome-wide analysis of siRNA accumulation in Arabidopsis treated with bacteria |
| 3 | GSM575246 | Genome-wide double-stranded RNA sequencing reveals the functional significance of base-paired RNAs in Arabidopsis |
| 3 | GSM707678 | Characterization of AGO1-/AGO4-associated smRNAs |
| 3 | GSM707690 | Characterization of AGO1-/AGO4-associated smRNAs |
| 2 | GSM118373 | High-throughput sequencing of small RNAs from Arabidopsis thaliana |
| 2 | GSM442933 | Uncovering small RNA-mediated responses to phosphate-deficiency in Arabidopsis by deep sequencing |
| 2 | GSM491569 | Genome-wide analysis of siRNA accumulation in Arabidopsis treated with bacteria |
| 2 | GSM491573 | Genome-wide analysis of siRNA accumulation in Arabidopsis treated with bacteria |
| 2 | GSM506663 | Accumulation of TuMV-derived siRNAs in aerial parts of Arabidopsis thaliana plants at 7 and 10 dpi |
| 2 | GSM506677 | Accumulation of TuMV-derived siRNAs in aerial parts of Arabidopsis thaliana plants at 7 and 10 dpi |
| 2 | GSM605659 | Homology-guided Assembly of the Genomes of the Four Diverse Accessions Ler, C24, Bur-0 and Kro-0 |
| 2 | GSM707689 | Characterization of AGO1-/AGO4-associated smRNAs |
| 1 | GSM118375 | High-throughput sequencing of small RNAs from Arabidopsis thaliana |
| 1 | GSM253622 | Small RNAs in four Argonaute complexes in Arabidopsis |
| 1 | GSM415786 | Arabidopsis Argonaute4, Argonaute6 and Argonaute9 associated small RNAs |
| 1 | GSM424744 | smRNAs in wildtype and RDR6-15 knockout Arabidopsis thaliana Col-0 leaf |
| 1 | GSM491570 | Genome-wide analysis of siRNA accumulation in Arabidopsis treated with bacteria |
| 1 | GSM506665 | Accumulation of TuMV-derived siRNAs in aerial parts of Arabidopsis thaliana plants at 7 and 10 dpi |
| 1 | GSM506684 | Accumulation of TuMV-derived siRNAs in aerial parts of Arabidopsis thaliana plants at 7 and 10 dpi |
| 1 | GSM506689 | Accumulation of TuMV-derived siRNAs in aerial parts of Arabidopsis thaliana plants at 7 and 10 dpi |
| 1 | GSM512702 | Genome-wide maps of AGO1-bound small RNA in Arabidopsis leaves |
| 1 | GSM512703 | Genome-wide maps of AGO1-bound small RNA in Arabidopsis leaves |
| 1 | GSM518446 | small RNAs sequences from grafted Arabidopsis thaliana and Nicotiana benthamiana tissues |
| 1 | GSM518447 | small RNAs sequences from grafted Arabidopsis thaliana and Nicotiana benthamiana tissues |
| 1 | GSM518457 | small RNAs sequences from grafted Arabidopsis thaliana and Nicotiana benthamiana tissues |
| 1 | GSM518466 | small RNAs sequences from grafted Arabidopsis thaliana and Nicotiana benthamiana tissues |
| 1 | GSM518467 | small RNAs sequences from grafted Arabidopsis thaliana and Nicotiana benthamiana tissues |
| 1 | GSM575247 | Genome-wide double-stranded RNA sequencing reveals the functional significance of base-paired RNAs in Arabidopsis |
| 1 | GSM605658 | Homology-guided Assembly of the Genomes of the Four Diverse Accessions Ler, C24, Bur-0 and Kro-0 |
| 1 | GSM707682 | Characterization of AGO1-/AGO4-associated smRNAs |