Sequence

CAACAAAGCACGUCUACUCUACUA

Expression details
CountSample IDExperiment title
2GSM385394Small RNAs in Arabidopsis hybrid siliques
2GSM707679Characterization of AGO1-/AGO4-associated smRNAs
1GSM518446small RNAs sequences from grafted Arabidopsis thaliana and Nicotiana benthamiana tissues
1GSM518447small RNAs sequences from grafted Arabidopsis thaliana and Nicotiana benthamiana tissues
1GSM518467small RNAs sequences from grafted Arabidopsis thaliana and Nicotiana benthamiana tissues
1GSM707687Characterization of AGO1-/AGO4-associated smRNAs