Sequence

UAGACCGAUGUCAACAAACAAGC

Expression details
CountSample IDExperiment title
2GSM707682Characterization of AGO1-/AGO4-associated smRNAs
1GSM253623Small RNAs in four Argonaute complexes in Arabidopsis
1GSM518443small RNAs sequences from grafted Arabidopsis thaliana and Nicotiana benthamiana tissues
1GSM518444small RNAs sequences from grafted Arabidopsis thaliana and Nicotiana benthamiana tissues
1GSM518450small RNAs sequences from grafted Arabidopsis thaliana and Nicotiana benthamiana tissues
1GSM707678Characterization of AGO1-/AGO4-associated smRNAs
1GSM707685Characterization of AGO1-/AGO4-associated smRNAs
1GSM707687Characterization of AGO1-/AGO4-associated smRNAs
1GSM707691Characterization of AGO1-/AGO4-associated smRNAs