UAGACCGAUGUCAACAAACAA
| Count | Sample ID | Experiment title |
|---|---|---|
| 10 | GSM707682 | Characterization of AGO1-/AGO4-associated smRNAs |
| 10 | GSM707685 | Characterization of AGO1-/AGO4-associated smRNAs |
| 8 | GSM707690 | Characterization of AGO1-/AGO4-associated smRNAs |
| 3 | GSM707678 | Characterization of AGO1-/AGO4-associated smRNAs |
| 1 | GSM257236 | High-throughput pyrosequencing of endogenous small RNAs from Arabidopsis thaliana wild-type and polIV mutants |
| 1 | GSM442932 | Uncovering small RNA-mediated responses to phosphate-deficiency in Arabidopsis by deep sequencing |
| 1 | GSM442935 | Uncovering small RNA-mediated responses to phosphate-deficiency in Arabidopsis by deep sequencing |
| 1 | GSM707679 | Characterization of AGO1-/AGO4-associated smRNAs |