Sequence

GUGAAAACAAACGGAGGAGUU

Expression details
CountSample IDExperiment title
4GSM707681Characterization of AGO1-/AGO4-associated smRNAs
3GSM707678Characterization of AGO1-/AGO4-associated smRNAs
1GSM277611Highly integrated single base resolution maps of the epigenome in Arabidopsis
1GSM506661Accumulation of TuMV-derived siRNAs in aerial parts of Arabidopsis thaliana plants at 7 and 10 dpi
1GSM605663Homology-guided Assembly of the Genomes of the Four Diverse Accessions Ler, C24, Bur-0 and Kro-0
1GSM707679Characterization of AGO1-/AGO4-associated smRNAs
1GSM707680Characterization of AGO1-/AGO4-associated smRNAs