UCUUCUCCAAAUAGUUUAGGU
| Count | Sample ID | Experiment title |
|---|---|---|
| 18 | GSM707685 | Characterization of AGO1-/AGO4-associated smRNAs |
| 13 | GSM707690 | Characterization of AGO1-/AGO4-associated smRNAs |
| 5 | GSM707683 | Characterization of AGO1-/AGO4-associated smRNAs |
| 4 | GSM707680 | Characterization of AGO1-/AGO4-associated smRNAs |
| 4 | GSM707691 | Characterization of AGO1-/AGO4-associated smRNAs |
| 2 | GSM506664 | Accumulation of TuMV-derived siRNAs in aerial parts of Arabidopsis thaliana plants at 7 and 10 dpi |
| 2 | GSM707679 | Characterization of AGO1-/AGO4-associated smRNAs |
| 1 | GSM343002 | AGO1-dependent Small RNA in Arabidopsis Identified by High-Throughput Sequencing |
| 1 | GSM506690 | Accumulation of TuMV-derived siRNAs in aerial parts of Arabidopsis thaliana plants at 7 and 10 dpi |
| 1 | GSM707678 | Characterization of AGO1-/AGO4-associated smRNAs |
| 1 | GSM707682 | Characterization of AGO1-/AGO4-associated smRNAs |
| 1 | GSM707684 | Characterization of AGO1-/AGO4-associated smRNAs |