UCCAAAUAGUUUAGGUUAGCUG
| Count | Sample ID | Experiment title |
|---|---|---|
| 2 | GSM575247 | Genome-wide double-stranded RNA sequencing reveals the functional significance of base-paired RNAs in Arabidopsis |
| 2 | GSM707683 | Characterization of AGO1-/AGO4-associated smRNAs |
| 2 | GSM707684 | Characterization of AGO1-/AGO4-associated smRNAs |
| 2 | GSM707691 | Characterization of AGO1-/AGO4-associated smRNAs |
| 1 | GSM154377 | Arabidopsis thaliana small RNAs sequences identified using high-throughput 454 sequencing technology |
| 1 | GSM442932 | Uncovering small RNA-mediated responses to phosphate-deficiency in Arabidopsis by deep sequencing |
| 1 | GSM442933 | Uncovering small RNA-mediated responses to phosphate-deficiency in Arabidopsis by deep sequencing |
| 1 | GSM456945 | Deep sequencing of small RNAs in the trasngenic wild type plant and the IWR1-type transcription factor mutant, dms4 |
| 1 | GSM506682 | Accumulation of TuMV-derived siRNAs in aerial parts of Arabidopsis thaliana plants at 7 and 10 dpi |
| 1 | GSM554062 | Global identification of Arabidopsis thaliana ARGONAUTE1-associated small RNA. |
| 1 | GSM707678 | Characterization of AGO1-/AGO4-associated smRNAs |
| 1 | GSM707682 | Characterization of AGO1-/AGO4-associated smRNAs |
| 1 | GSM707685 | Characterization of AGO1-/AGO4-associated smRNAs |