UCUUGCUUAAAUGAGUAUUCC
| Count | Sample ID | Experiment title |
|---|---|---|
| 85 | GSM707683 | Characterization of AGO1-/AGO4-associated smRNAs |
| 13 | GSM707679 | Characterization of AGO1-/AGO4-associated smRNAs |
| 7 | GSM707685 | Characterization of AGO1-/AGO4-associated smRNAs |
| 4 | GSM707682 | Characterization of AGO1-/AGO4-associated smRNAs |
| 3 | GSM707678 | Characterization of AGO1-/AGO4-associated smRNAs |
| 3 | GSM707690 | Characterization of AGO1-/AGO4-associated smRNAs |
| 2 | GSM506680 | Accumulation of TuMV-derived siRNAs in aerial parts of Arabidopsis thaliana plants at 7 and 10 dpi |
| 1 | GSM257237 | High-throughput pyrosequencing of endogenous small RNAs from Arabidopsis thaliana wild-type and polIV mutants |
| 1 | GSM442935 | Uncovering small RNA-mediated responses to phosphate-deficiency in Arabidopsis by deep sequencing |
| 1 | GSM506663 | Accumulation of TuMV-derived siRNAs in aerial parts of Arabidopsis thaliana plants at 7 and 10 dpi |
| 1 | GSM506665 | Accumulation of TuMV-derived siRNAs in aerial parts of Arabidopsis thaliana plants at 7 and 10 dpi |
| 1 | GSM707686 | Characterization of AGO1-/AGO4-associated smRNAs |