UAUUUCACGAAGAUAUCUGCA
Count | Sample ID | Experiment title |
---|---|---|
2 | GSM707682 | Characterization of AGO1-/AGO4-associated smRNAs |
1 | GSM253624 | Small RNAs in four Argonaute complexes in Arabidopsis |
1 | GSM343002 | AGO1-dependent Small RNA in Arabidopsis Identified by High-Throughput Sequencing |
1 | GSM605660 | Homology-guided Assembly of the Genomes of the Four Diverse Accessions Ler, C24, Bur-0 and Kro-0 |
1 | GSM605662 | Homology-guided Assembly of the Genomes of the Four Diverse Accessions Ler, C24, Bur-0 and Kro-0 |
1 | GSM707678 | Characterization of AGO1-/AGO4-associated smRNAs |
1 | GSM707690 | Characterization of AGO1-/AGO4-associated smRNAs |