UAUCAGAUAUUUCACGAAGAUA
Count | Sample ID | Experiment title |
---|---|---|
105 | GSM707690 | Characterization of AGO1-/AGO4-associated smRNAs |
64 | GSM707682 | Characterization of AGO1-/AGO4-associated smRNAs |
40 | GSM707678 | Characterization of AGO1-/AGO4-associated smRNAs |
12 | GSM253622 | Small RNAs in four Argonaute complexes in Arabidopsis |
5 | GSM257236 | High-throughput pyrosequencing of endogenous small RNAs from Arabidopsis thaliana wild-type and polIV mutants |
5 | GSM707686 | Characterization of AGO1-/AGO4-associated smRNAs |
2 | GSM605660 | Homology-guided Assembly of the Genomes of the Four Diverse Accessions Ler, C24, Bur-0 and Kro-0 |
2 | GSM605662 | Homology-guided Assembly of the Genomes of the Four Diverse Accessions Ler, C24, Bur-0 and Kro-0 |
1 | GSM253624 | Small RNAs in four Argonaute complexes in Arabidopsis |
1 | GSM253625 | Small RNAs in four Argonaute complexes in Arabidopsis |
1 | GSM257237 | High-throughput pyrosequencing of endogenous small RNAs from Arabidopsis thaliana wild-type and polIV mutants |
1 | GSM304282 | ARGONAUTE-small RNA Interactions in Arabidopsis thaliana Identified by High-Throughput Sequencing |
1 | GSM342999 | AGO1-dependent Small RNA in Arabidopsis Identified by High-Throughput Sequencing |
1 | GSM343000 | AGO1-dependent Small RNA in Arabidopsis Identified by High-Throughput Sequencing |
1 | GSM415784 | Arabidopsis Argonaute4, Argonaute6 and Argonaute9 associated small RNAs |
1 | GSM707680 | Characterization of AGO1-/AGO4-associated smRNAs |
1 | GSM707684 | Characterization of AGO1-/AGO4-associated smRNAs |