CUUCGUGAAUAUCUGGCAUU
Count | Sample ID | Experiment title |
---|---|---|
10 | GSM707690 | Characterization of AGO1-/AGO4-associated smRNAs |
4 | GSM343002 | AGO1-dependent Small RNA in Arabidopsis Identified by High-Throughput Sequencing |
2 | GSM707678 | Characterization of AGO1-/AGO4-associated smRNAs |
1 | GSM253625 | Small RNAs in four Argonaute complexes in Arabidopsis |
1 | GSM415798 | Arabidopsis Argonaute4, Argonaute6 and Argonaute9 associated small RNAs |
1 | GSM415799 | Arabidopsis Argonaute4, Argonaute6 and Argonaute9 associated small RNAs |
1 | GSM456945 | Deep sequencing of small RNAs in the trasngenic wild type plant and the IWR1-type transcription factor mutant, dms4 |
1 | GSM605659 | Homology-guided Assembly of the Genomes of the Four Diverse Accessions Ler, C24, Bur-0 and Kro-0 |
1 | GSM605661 | Homology-guided Assembly of the Genomes of the Four Diverse Accessions Ler, C24, Bur-0 and Kro-0 |
1 | GSM707682 | Characterization of AGO1-/AGO4-associated smRNAs |