CUAGCAGCUGUUGAGCAGGUUUC
Count | Sample ID | Experiment title |
---|---|---|
1 | GSM284747 | A link between RNA metabolism and silencing affecting Arabidopsis development |
1 | GSM456944 | Deep sequencing of small RNAs in the trasngenic wild type plant and the IWR1-type transcription factor mutant, dms4 |
1 | GSM575246 | Genome-wide double-stranded RNA sequencing reveals the functional significance of base-paired RNAs in Arabidopsis |