CUCAAUAGAAUUCUUAAGAU
Count | Sample ID | Experiment title |
---|---|---|
2 | GSM605662 | Homology-guided Assembly of the Genomes of the Four Diverse Accessions Ler, C24, Bur-0 and Kro-0 |
1 | GSM277609 | Highly integrated single base resolution maps of the epigenome in Arabidopsis |
1 | GSM575247 | Genome-wide double-stranded RNA sequencing reveals the functional significance of base-paired RNAs in Arabidopsis |