CAAAUCCAUCGGAACCCUAAACAU
| Count | Sample ID | Experiment title |
|---|---|---|
| 2 | GSM707682 | Characterization of AGO1-/AGO4-associated smRNAs |
| 1 | GSM284748 | A link between RNA metabolism and silencing affecting Arabidopsis development |
| 1 | GSM518441 | small RNAs sequences from grafted Arabidopsis thaliana and Nicotiana benthamiana tissues |
| 1 | GSM518447 | small RNAs sequences from grafted Arabidopsis thaliana and Nicotiana benthamiana tissues |
| 1 | GSM518466 | small RNAs sequences from grafted Arabidopsis thaliana and Nicotiana benthamiana tissues |