AUCCAUCGGAACCCUAAACAUCUC
| Count | Sample ID | Experiment title |
|---|---|---|
| 3 | GSM707686 | Characterization of AGO1-/AGO4-associated smRNAs |
| 2 | GSM707688 | Characterization of AGO1-/AGO4-associated smRNAs |
| 1 | GSM575246 | Genome-wide double-stranded RNA sequencing reveals the functional significance of base-paired RNAs in Arabidopsis |
| 1 | GSM707678 | Characterization of AGO1-/AGO4-associated smRNAs |
| 1 | GSM707679 | Characterization of AGO1-/AGO4-associated smRNAs |
| 1 | GSM707684 | Characterization of AGO1-/AGO4-associated smRNAs |