Sequence

ACUCAAUAGAAUUCUUAAGA

Expression details
CountSample IDExperiment title
7GSM707690Characterization of AGO1-/AGO4-associated smRNAs
3GSM605662Homology-guided Assembly of the Genomes of the Four Diverse Accessions Ler, C24, Bur-0 and Kro-0
1GSM257236High-throughput pyrosequencing of endogenous small RNAs from Arabidopsis thaliana wild-type and polIV mutants
1GSM277610Highly integrated single base resolution maps of the epigenome in Arabidopsis
1GSM605658Homology-guided Assembly of the Genomes of the Four Diverse Accessions Ler, C24, Bur-0 and Kro-0
1GSM605665Homology-guided Assembly of the Genomes of the Four Diverse Accessions Ler, C24, Bur-0 and Kro-0
1GSM707678Characterization of AGO1-/AGO4-associated smRNAs
1GSM707682Characterization of AGO1-/AGO4-associated smRNAs