AAAUCCAUCGGAACCCUAAAC
Count | Sample ID | Experiment title |
---|---|---|
1 | GSM284749 | A link between RNA metabolism and silencing affecting Arabidopsis development |
1 | GSM415795 | Arabidopsis Argonaute4, Argonaute6 and Argonaute9 associated small RNAs |
1 | GSM518443 | small RNAs sequences from grafted Arabidopsis thaliana and Nicotiana benthamiana tissues |
1 | GSM575246 | Genome-wide double-stranded RNA sequencing reveals the functional significance of base-paired RNAs in Arabidopsis |