UUUUCGAUGUCUAGCAGUGCCAAUG
| Count | Sample ID | Experiment title |
|---|---|---|
| 1 | GSM118375 | High-throughput sequencing of small RNAs from Arabidopsis thaliana |
| 1 | GSM154368 | Arabidopsis thaliana small RNAs sequences identified using high-throughput 454 sequencing technology |
| 1 | GSM253624 | Small RNAs in four Argonaute complexes in Arabidopsis |
| 1 | GSM253625 | Small RNAs in four Argonaute complexes in Arabidopsis |
| 1 | GSM707678 | Characterization of AGO1-/AGO4-associated smRNAs |
| 1 | GSM707682 | Characterization of AGO1-/AGO4-associated smRNAs |
| 1 | GSM707689 | Characterization of AGO1-/AGO4-associated smRNAs |
| 1 | GSM707691 | Characterization of AGO1-/AGO4-associated smRNAs |
| 1 | GSM711894 | Small RNA sequencing in nine-day old nutrient-replete and N or P-limited wild type Arabidopsis seedlings |