Sequence

UCGAUGUCUAGCAGUGCCAAU

Expression details
CountSample IDExperiment title
3GSM491571Genome-wide analysis of siRNA accumulation in Arabidopsis treated with bacteria
3GSM707690Characterization of AGO1-/AGO4-associated smRNAs
2GSM491570Genome-wide analysis of siRNA accumulation in Arabidopsis treated with bacteria
2GSM707682Characterization of AGO1-/AGO4-associated smRNAs
1GSM154368Arabidopsis thaliana small RNAs sequences identified using high-throughput 454 sequencing technology
1GSM277608Highly integrated single base resolution maps of the epigenome in Arabidopsis
1GSM415785Arabidopsis Argonaute4, Argonaute6 and Argonaute9 associated small RNAs
1GSM415796Arabidopsis Argonaute4, Argonaute6 and Argonaute9 associated small RNAs
1GSM415797Arabidopsis Argonaute4, Argonaute6 and Argonaute9 associated small RNAs
1GSM415798Arabidopsis Argonaute4, Argonaute6 and Argonaute9 associated small RNAs
1GSM491576Genome-wide analysis of siRNA accumulation in Arabidopsis treated with bacteria
1GSM575246Genome-wide double-stranded RNA sequencing reveals the functional significance of base-paired RNAs in Arabidopsis
1GSM707681Characterization of AGO1-/AGO4-associated smRNAs
1GSM707683Characterization of AGO1-/AGO4-associated smRNAs
1GSM707687Characterization of AGO1-/AGO4-associated smRNAs