Sequence

GUUUGUUCAAAGACAUUUUCG

Expression details
CountSample IDExperiment title
5GSM506689Accumulation of TuMV-derived siRNAs in aerial parts of Arabidopsis thaliana plants at 7 and 10 dpi
1GSM506683Accumulation of TuMV-derived siRNAs in aerial parts of Arabidopsis thaliana plants at 7 and 10 dpi
1GSM506690Accumulation of TuMV-derived siRNAs in aerial parts of Arabidopsis thaliana plants at 7 and 10 dpi
1GSM707690Characterization of AGO1-/AGO4-associated smRNAs