Sequence

UGCACUGCCUCUUCCCUGGCUCCC

Expression details
CountSample IDExperiment title
10GSM707685Characterization of AGO1-/AGO4-associated smRNAs
4GSM506664Accumulation of TuMV-derived siRNAs in aerial parts of Arabidopsis thaliana plants at 7 and 10 dpi
2GSM506672Accumulation of TuMV-derived siRNAs in aerial parts of Arabidopsis thaliana plants at 7 and 10 dpi
2GSM707689Characterization of AGO1-/AGO4-associated smRNAs
1GSM518452small RNAs sequences from grafted Arabidopsis thaliana and Nicotiana benthamiana tissues
1GSM518461small RNAs sequences from grafted Arabidopsis thaliana and Nicotiana benthamiana tissues
1GSM707690Characterization of AGO1-/AGO4-associated smRNAs