Sequence

GCACUGCCUCUUCCCUGGCU

Expression details
CountSample IDExperiment title
51GSM707681Characterization of AGO1-/AGO4-associated smRNAs
43GSM707685Characterization of AGO1-/AGO4-associated smRNAs
34GSM707690Characterization of AGO1-/AGO4-associated smRNAs
28GSM707678Characterization of AGO1-/AGO4-associated smRNAs
20GSM707682Characterization of AGO1-/AGO4-associated smRNAs
1GSM415785Arabidopsis Argonaute4, Argonaute6 and Argonaute9 associated small RNAs
1GSM415799Arabidopsis Argonaute4, Argonaute6 and Argonaute9 associated small RNAs
1GSM506666Accumulation of TuMV-derived siRNAs in aerial parts of Arabidopsis thaliana plants at 7 and 10 dpi
1GSM506689Accumulation of TuMV-derived siRNAs in aerial parts of Arabidopsis thaliana plants at 7 and 10 dpi
1GSM575247Genome-wide double-stranded RNA sequencing reveals the functional significance of base-paired RNAs in Arabidopsis