CUCUUCCCUGGCUCCCUCUUU
| Count | Sample ID | Experiment title |
|---|---|---|
| 11 | GSM707681 | Characterization of AGO1-/AGO4-associated smRNAs |
| 10 | GSM707678 | Characterization of AGO1-/AGO4-associated smRNAs |
| 10 | GSM707690 | Characterization of AGO1-/AGO4-associated smRNAs |
| 3 | GSM707685 | Characterization of AGO1-/AGO4-associated smRNAs |
| 2 | GSM707682 | Characterization of AGO1-/AGO4-associated smRNAs |
| 1 | GSM506679 | Accumulation of TuMV-derived siRNAs in aerial parts of Arabidopsis thaliana plants at 7 and 10 dpi |
| 1 | GSM518432 | MIRNA Gene Evolution in Arabidopsis lyrata and Arabidopsis thaliana |