Sequence

AGAGACAGGGAACAAGCAGAGCA

Expression details
CountSample IDExperiment title
32GSM707689Characterization of AGO1-/AGO4-associated smRNAs
11GSM707685Characterization of AGO1-/AGO4-associated smRNAs
10GSM605659Homology-guided Assembly of the Genomes of the Four Diverse Accessions Ler, C24, Bur-0 and Kro-0
5GSM424847Low oxygen responsive small RNAs in Arabidopsis
5GSM605658Homology-guided Assembly of the Genomes of the Four Diverse Accessions Ler, C24, Bur-0 and Kro-0
4GSM253624Small RNAs in four Argonaute complexes in Arabidopsis
4GSM491574Genome-wide analysis of siRNA accumulation in Arabidopsis treated with bacteria
4GSM605660Homology-guided Assembly of the Genomes of the Four Diverse Accessions Ler, C24, Bur-0 and Kro-0
4GSM711893Small RNA sequencing in nine-day old nutrient-replete and N or P-limited wild type Arabidopsis seedlings
2GSM277609Highly integrated single base resolution maps of the epigenome in Arabidopsis
2GSM491576Genome-wide analysis of siRNA accumulation in Arabidopsis treated with bacteria
2GSM575246Genome-wide double-stranded RNA sequencing reveals the functional significance of base-paired RNAs in Arabidopsis
2GSM605661Homology-guided Assembly of the Genomes of the Four Diverse Accessions Ler, C24, Bur-0 and Kro-0
2GSM605662Homology-guided Assembly of the Genomes of the Four Diverse Accessions Ler, C24, Bur-0 and Kro-0
2GSM605664Homology-guided Assembly of the Genomes of the Four Diverse Accessions Ler, C24, Bur-0 and Kro-0
1GSM277610Highly integrated single base resolution maps of the epigenome in Arabidopsis
1GSM277611Highly integrated single base resolution maps of the epigenome in Arabidopsis
1GSM284747A link between RNA metabolism and silencing affecting Arabidopsis development
1GSM284749A link between RNA metabolism and silencing affecting Arabidopsis development
1GSM284750A link between RNA metabolism and silencing affecting Arabidopsis development
1GSM385393Small RNAs in Arabidopsis hybrid siliques
1GSM385394Small RNAs in Arabidopsis hybrid siliques
1GSM415784Arabidopsis Argonaute4, Argonaute6 and Argonaute9 associated small RNAs
1GSM415789Arabidopsis Argonaute4, Argonaute6 and Argonaute9 associated small RNAs
1GSM415790Arabidopsis Argonaute4, Argonaute6 and Argonaute9 associated small RNAs
1GSM415801Arabidopsis Argonaute4, Argonaute6 and Argonaute9 associated small RNAs
1GSM424848Low oxygen responsive small RNAs in Arabidopsis
1GSM442932Uncovering small RNA-mediated responses to phosphate-deficiency in Arabidopsis by deep sequencing
1GSM442934Uncovering small RNA-mediated responses to phosphate-deficiency in Arabidopsis by deep sequencing
1GSM456944Deep sequencing of small RNAs in the trasngenic wild type plant and the IWR1-type transcription factor mutant, dms4
1GSM456945Deep sequencing of small RNAs in the trasngenic wild type plant and the IWR1-type transcription factor mutant, dms4
1GSM491569Genome-wide analysis of siRNA accumulation in Arabidopsis treated with bacteria
1GSM491572Genome-wide analysis of siRNA accumulation in Arabidopsis treated with bacteria
1GSM491577Genome-wide analysis of siRNA accumulation in Arabidopsis treated with bacteria
1GSM518430MIRNA Gene Evolution in Arabidopsis lyrata and Arabidopsis thaliana
1GSM518438small RNAs sequences from grafted Arabidopsis thaliana and Nicotiana benthamiana tissues
1GSM518439small RNAs sequences from grafted Arabidopsis thaliana and Nicotiana benthamiana tissues
1GSM518440small RNAs sequences from grafted Arabidopsis thaliana and Nicotiana benthamiana tissues
1GSM518441small RNAs sequences from grafted Arabidopsis thaliana and Nicotiana benthamiana tissues
1GSM518442small RNAs sequences from grafted Arabidopsis thaliana and Nicotiana benthamiana tissues
1GSM518443small RNAs sequences from grafted Arabidopsis thaliana and Nicotiana benthamiana tissues
1GSM518444small RNAs sequences from grafted Arabidopsis thaliana and Nicotiana benthamiana tissues
1GSM518445small RNAs sequences from grafted Arabidopsis thaliana and Nicotiana benthamiana tissues
1GSM518446small RNAs sequences from grafted Arabidopsis thaliana and Nicotiana benthamiana tissues
1GSM518447small RNAs sequences from grafted Arabidopsis thaliana and Nicotiana benthamiana tissues
1GSM518448small RNAs sequences from grafted Arabidopsis thaliana and Nicotiana benthamiana tissues
1GSM518449small RNAs sequences from grafted Arabidopsis thaliana and Nicotiana benthamiana tissues
1GSM518450small RNAs sequences from grafted Arabidopsis thaliana and Nicotiana benthamiana tissues
1GSM518451small RNAs sequences from grafted Arabidopsis thaliana and Nicotiana benthamiana tissues
1GSM518452small RNAs sequences from grafted Arabidopsis thaliana and Nicotiana benthamiana tissues
1GSM518453small RNAs sequences from grafted Arabidopsis thaliana and Nicotiana benthamiana tissues
1GSM518454small RNAs sequences from grafted Arabidopsis thaliana and Nicotiana benthamiana tissues
1GSM518455small RNAs sequences from grafted Arabidopsis thaliana and Nicotiana benthamiana tissues
1GSM518456small RNAs sequences from grafted Arabidopsis thaliana and Nicotiana benthamiana tissues
1GSM518457small RNAs sequences from grafted Arabidopsis thaliana and Nicotiana benthamiana tissues
1GSM518458small RNAs sequences from grafted Arabidopsis thaliana and Nicotiana benthamiana tissues
1GSM518459small RNAs sequences from grafted Arabidopsis thaliana and Nicotiana benthamiana tissues
1GSM518460small RNAs sequences from grafted Arabidopsis thaliana and Nicotiana benthamiana tissues
1GSM518461small RNAs sequences from grafted Arabidopsis thaliana and Nicotiana benthamiana tissues
1GSM518462small RNAs sequences from grafted Arabidopsis thaliana and Nicotiana benthamiana tissues
1GSM518463small RNAs sequences from grafted Arabidopsis thaliana and Nicotiana benthamiana tissues
1GSM518464small RNAs sequences from grafted Arabidopsis thaliana and Nicotiana benthamiana tissues
1GSM518465small RNAs sequences from grafted Arabidopsis thaliana and Nicotiana benthamiana tissues
1GSM518466small RNAs sequences from grafted Arabidopsis thaliana and Nicotiana benthamiana tissues
1GSM518467small RNAs sequences from grafted Arabidopsis thaliana and Nicotiana benthamiana tissues
1GSM605665Homology-guided Assembly of the Genomes of the Four Diverse Accessions Ler, C24, Bur-0 and Kro-0
1GSM707686Characterization of AGO1-/AGO4-associated smRNAs
1GSM711892Small RNA sequencing in nine-day old nutrient-replete and N or P-limited wild type Arabidopsis seedlings