UGCCAAAGGAGAUUUGCCCCG
Count | Sample ID | Experiment title |
---|---|---|
624 | GSM442932 | Uncovering small RNA-mediated responses to phosphate-deficiency in Arabidopsis by deep sequencing |
315 | GSM711892 | Small RNA sequencing in nine-day old nutrient-replete and N or P-limited wild type Arabidopsis seedlings |
212 | GSM442934 | Uncovering small RNA-mediated responses to phosphate-deficiency in Arabidopsis by deep sequencing |
126 | GSM707685 | Characterization of AGO1-/AGO4-associated smRNAs |
108 | GSM707681 | Characterization of AGO1-/AGO4-associated smRNAs |
96 | GSM711893 | Small RNA sequencing in nine-day old nutrient-replete and N or P-limited wild type Arabidopsis seedlings |
93 | GSM707682 | Characterization of AGO1-/AGO4-associated smRNAs |
70 | GSM707690 | Characterization of AGO1-/AGO4-associated smRNAs |
32 | GSM506689 | Accumulation of TuMV-derived siRNAs in aerial parts of Arabidopsis thaliana plants at 7 and 10 dpi |
5 | GSM118372 | High-throughput sequencing of small RNAs from Arabidopsis thaliana |
5 | GSM424847 | Low oxygen responsive small RNAs in Arabidopsis |
4 | GSM387522 | Small RNAs serve as a genetic buffer against genomic shock in Arabidopsis interspecific hybrids and allopolyploids |
4 | GSM506690 | Accumulation of TuMV-derived siRNAs in aerial parts of Arabidopsis thaliana plants at 7 and 10 dpi |
3 | GSM118375 | High-throughput sequencing of small RNAs from Arabidopsis thaliana |
3 | GSM343002 | AGO1-dependent Small RNA in Arabidopsis Identified by High-Throughput Sequencing |
3 | GSM506667 | Accumulation of TuMV-derived siRNAs in aerial parts of Arabidopsis thaliana plants at 7 and 10 dpi |
2 | GSM149079 | Small RNAs in Arabidopsis thaliana and its RISC complexes |
2 | GSM253622 | Small RNAs in four Argonaute complexes in Arabidopsis |
2 | GSM506685 | Accumulation of TuMV-derived siRNAs in aerial parts of Arabidopsis thaliana plants at 7 and 10 dpi |
2 | GSM506691 | Accumulation of TuMV-derived siRNAs in aerial parts of Arabidopsis thaliana plants at 7 and 10 dpi |
1 | GSM154377 | Arabidopsis thaliana small RNAs sequences identified using high-throughput 454 sequencing technology |
1 | GSM343005 | AGO1-dependent Small RNA in Arabidopsis Identified by High-Throughput Sequencing |
1 | GSM424848 | Low oxygen responsive small RNAs in Arabidopsis |
1 | GSM506665 | Accumulation of TuMV-derived siRNAs in aerial parts of Arabidopsis thaliana plants at 7 and 10 dpi |
1 | GSM506666 | Accumulation of TuMV-derived siRNAs in aerial parts of Arabidopsis thaliana plants at 7 and 10 dpi |
1 | GSM506681 | Accumulation of TuMV-derived siRNAs in aerial parts of Arabidopsis thaliana plants at 7 and 10 dpi |
1 | GSM512702 | Genome-wide maps of AGO1-bound small RNA in Arabidopsis leaves |
1 | GSM518444 | small RNAs sequences from grafted Arabidopsis thaliana and Nicotiana benthamiana tissues |
1 | GSM554064 | Global identification of Arabidopsis thaliana ARGONAUTE1-associated small RNA. |
1 | GSM554065 | Global identification of Arabidopsis thaliana ARGONAUTE1-associated small RNA. |
1 | GSM575246 | Genome-wide double-stranded RNA sequencing reveals the functional significance of base-paired RNAs in Arabidopsis |
1 | GSM605661 | Homology-guided Assembly of the Genomes of the Four Diverse Accessions Ler, C24, Bur-0 and Kro-0 |
1 | GSM605664 | Homology-guided Assembly of the Genomes of the Four Diverse Accessions Ler, C24, Bur-0 and Kro-0 |
1 | GSM707678 | Characterization of AGO1-/AGO4-associated smRNAs |
1 | GSM707683 | Characterization of AGO1-/AGO4-associated smRNAs |
1 | GSM707689 | Characterization of AGO1-/AGO4-associated smRNAs |