CUCGACAGGGUUGAUAUGAGAACA
Count | Sample ID | Experiment title |
---|---|---|
4 | GSM506672 | Accumulation of TuMV-derived siRNAs in aerial parts of Arabidopsis thaliana plants at 7 and 10 dpi |
1 | GSM366868 | Computational and Analytical Framework for Small RNA Profiling by High-Throughput Sequencing |
1 | GSM506669 | Accumulation of TuMV-derived siRNAs in aerial parts of Arabidopsis thaliana plants at 7 and 10 dpi |