UCUUGAUGAUGCUGCAGCGGC
Count | Sample ID | Experiment title |
---|---|---|
2 | GSM506684 | Accumulation of TuMV-derived siRNAs in aerial parts of Arabidopsis thaliana plants at 7 and 10 dpi |
2 | GSM506689 | Accumulation of TuMV-derived siRNAs in aerial parts of Arabidopsis thaliana plants at 7 and 10 dpi |
1 | GSM415797 | Arabidopsis Argonaute4, Argonaute6 and Argonaute9 associated small RNAs |
1 | GSM506665 | Accumulation of TuMV-derived siRNAs in aerial parts of Arabidopsis thaliana plants at 7 and 10 dpi |
1 | GSM506672 | Accumulation of TuMV-derived siRNAs in aerial parts of Arabidopsis thaliana plants at 7 and 10 dpi |
1 | GSM506673 | Accumulation of TuMV-derived siRNAs in aerial parts of Arabidopsis thaliana plants at 7 and 10 dpi |
1 | GSM512703 | Genome-wide maps of AGO1-bound small RNA in Arabidopsis leaves |