GAUGCUGCAGCGGCAAUUAAAUGG
| Count | Sample ID | Experiment title |
|---|---|---|
| 1 | GSM491575 | Genome-wide analysis of siRNA accumulation in Arabidopsis treated with bacteria |
| 1 | GSM518444 | small RNAs sequences from grafted Arabidopsis thaliana and Nicotiana benthamiana tissues |
| 1 | GSM518445 | small RNAs sequences from grafted Arabidopsis thaliana and Nicotiana benthamiana tissues |
| 1 | GSM518447 | small RNAs sequences from grafted Arabidopsis thaliana and Nicotiana benthamiana tissues |
| 1 | GSM518454 | small RNAs sequences from grafted Arabidopsis thaliana and Nicotiana benthamiana tissues |
| 1 | GSM518455 | small RNAs sequences from grafted Arabidopsis thaliana and Nicotiana benthamiana tissues |
| 1 | GSM518463 | small RNAs sequences from grafted Arabidopsis thaliana and Nicotiana benthamiana tissues |
| 1 | GSM518466 | small RNAs sequences from grafted Arabidopsis thaliana and Nicotiana benthamiana tissues |
| 1 | GSM518467 | small RNAs sequences from grafted Arabidopsis thaliana and Nicotiana benthamiana tissues |
| 1 | GSM707680 | Characterization of AGO1-/AGO4-associated smRNAs |