GAGAAUCUUGAUGAUGCUGCA
Count | Sample ID | Experiment title |
---|---|---|
57 | GSM518389 | MIRNA Gene Evolution in Arabidopsis lyrata and Arabidopsis thaliana |
53 | GSM518429 | MIRNA Gene Evolution in Arabidopsis lyrata and Arabidopsis thaliana |
41 | GSM506687 | Accumulation of TuMV-derived siRNAs in aerial parts of Arabidopsis thaliana plants at 7 and 10 dpi |
28 | GSM506690 | Accumulation of TuMV-derived siRNAs in aerial parts of Arabidopsis thaliana plants at 7 and 10 dpi |
26 | GSM253624 | Small RNAs in four Argonaute complexes in Arabidopsis |
21 | GSM506680 | Accumulation of TuMV-derived siRNAs in aerial parts of Arabidopsis thaliana plants at 7 and 10 dpi |
18 | GSM506666 | Accumulation of TuMV-derived siRNAs in aerial parts of Arabidopsis thaliana plants at 7 and 10 dpi |
14 | GSM149080 | Small RNAs in Arabidopsis thaliana and its RISC complexes |
14 | GSM506662 | Accumulation of TuMV-derived siRNAs in aerial parts of Arabidopsis thaliana plants at 7 and 10 dpi |
14 | GSM506675 | Accumulation of TuMV-derived siRNAs in aerial parts of Arabidopsis thaliana plants at 7 and 10 dpi |
13 | GSM506681 | Accumulation of TuMV-derived siRNAs in aerial parts of Arabidopsis thaliana plants at 7 and 10 dpi |
12 | GSM506684 | Accumulation of TuMV-derived siRNAs in aerial parts of Arabidopsis thaliana plants at 7 and 10 dpi |
11 | GSM506689 | Accumulation of TuMV-derived siRNAs in aerial parts of Arabidopsis thaliana plants at 7 and 10 dpi |
10 | GSM506661 | Accumulation of TuMV-derived siRNAs in aerial parts of Arabidopsis thaliana plants at 7 and 10 dpi |
10 | GSM506664 | Accumulation of TuMV-derived siRNAs in aerial parts of Arabidopsis thaliana plants at 7 and 10 dpi |
10 | GSM506686 | Accumulation of TuMV-derived siRNAs in aerial parts of Arabidopsis thaliana plants at 7 and 10 dpi |
9 | GSM506658 | Accumulation of TuMV-derived siRNAs in aerial parts of Arabidopsis thaliana plants at 7 and 10 dpi |
8 | GSM506678 | Accumulation of TuMV-derived siRNAs in aerial parts of Arabidopsis thaliana plants at 7 and 10 dpi |
7 | GSM506691 | Accumulation of TuMV-derived siRNAs in aerial parts of Arabidopsis thaliana plants at 7 and 10 dpi |
6 | GSM277608 | Highly integrated single base resolution maps of the epigenome in Arabidopsis |
6 | GSM506685 | Accumulation of TuMV-derived siRNAs in aerial parts of Arabidopsis thaliana plants at 7 and 10 dpi |
6 | GSM506688 | Accumulation of TuMV-derived siRNAs in aerial parts of Arabidopsis thaliana plants at 7 and 10 dpi |
5 | GSM506660 | Accumulation of TuMV-derived siRNAs in aerial parts of Arabidopsis thaliana plants at 7 and 10 dpi |
5 | GSM506665 | Accumulation of TuMV-derived siRNAs in aerial parts of Arabidopsis thaliana plants at 7 and 10 dpi |
5 | GSM707690 | Characterization of AGO1-/AGO4-associated smRNAs |
4 | GSM284747 | A link between RNA metabolism and silencing affecting Arabidopsis development |
4 | GSM284748 | A link between RNA metabolism and silencing affecting Arabidopsis development |
4 | GSM284749 | A link between RNA metabolism and silencing affecting Arabidopsis development |
4 | GSM491572 | Genome-wide analysis of siRNA accumulation in Arabidopsis treated with bacteria |
4 | GSM506656 | Accumulation of TuMV-derived siRNAs in aerial parts of Arabidopsis thaliana plants at 7 and 10 dpi |
4 | GSM506679 | Accumulation of TuMV-derived siRNAs in aerial parts of Arabidopsis thaliana plants at 7 and 10 dpi |
4 | GSM518430 | MIRNA Gene Evolution in Arabidopsis lyrata and Arabidopsis thaliana |
4 | GSM554064 | Global identification of Arabidopsis thaliana ARGONAUTE1-associated small RNA. |
3 | GSM343001 | AGO1-dependent Small RNA in Arabidopsis Identified by High-Throughput Sequencing |
3 | GSM442932 | Uncovering small RNA-mediated responses to phosphate-deficiency in Arabidopsis by deep sequencing |
3 | GSM506663 | Accumulation of TuMV-derived siRNAs in aerial parts of Arabidopsis thaliana plants at 7 and 10 dpi |
3 | GSM605658 | Homology-guided Assembly of the Genomes of the Four Diverse Accessions Ler, C24, Bur-0 and Kro-0 |
3 | GSM707679 | Characterization of AGO1-/AGO4-associated smRNAs |
2 | GSM253622 | Small RNAs in four Argonaute complexes in Arabidopsis |
2 | GSM253625 | Small RNAs in four Argonaute complexes in Arabidopsis |
2 | GSM277611 | Highly integrated single base resolution maps of the epigenome in Arabidopsis |
2 | GSM366867 | Computational and Analytical Framework for Small RNA Profiling by High-Throughput Sequencing (reproducibility) |
2 | GSM442933 | Uncovering small RNA-mediated responses to phosphate-deficiency in Arabidopsis by deep sequencing |
2 | GSM506667 | Accumulation of TuMV-derived siRNAs in aerial parts of Arabidopsis thaliana plants at 7 and 10 dpi |
2 | GSM506668 | Accumulation of TuMV-derived siRNAs in aerial parts of Arabidopsis thaliana plants at 7 and 10 dpi |
2 | GSM506671 | Accumulation of TuMV-derived siRNAs in aerial parts of Arabidopsis thaliana plants at 7 and 10 dpi |
2 | GSM506682 | Accumulation of TuMV-derived siRNAs in aerial parts of Arabidopsis thaliana plants at 7 and 10 dpi |
2 | GSM506683 | Accumulation of TuMV-derived siRNAs in aerial parts of Arabidopsis thaliana plants at 7 and 10 dpi |
2 | GSM518431 | MIRNA Gene Evolution in Arabidopsis lyrata and Arabidopsis thaliana |
2 | GSM707678 | Characterization of AGO1-/AGO4-associated smRNAs |
2 | GSM707684 | Characterization of AGO1-/AGO4-associated smRNAs |
2 | GSM707691 | Characterization of AGO1-/AGO4-associated smRNAs |
1 | GSM149079 | Small RNAs in Arabidopsis thaliana and its RISC complexes |
1 | GSM149081 | Small RNAs in Arabidopsis thaliana and its RISC complexes |
1 | GSM154365 | Arabidopsis thaliana small RNAs sequences identified using high-throughput 454 sequencing technology |
1 | GSM277610 | Highly integrated single base resolution maps of the epigenome in Arabidopsis |
1 | GSM342999 | AGO1-dependent Small RNA in Arabidopsis Identified by High-Throughput Sequencing |
1 | GSM366869 | Computational and Analytical Framework for Small RNA Profiling by High-Throughput Sequencing |
1 | GSM366870 | Computational and Analytical Framework for Small RNA Profiling by High-Throughput Sequencing |
1 | GSM387515 | Small RNAs serve as a genetic buffer against genomic shock in Arabidopsis interspecific hybrids and allopolyploids |
1 | GSM415783 | Arabidopsis Argonaute4, Argonaute6 and Argonaute9 associated small RNAs |
1 | GSM415784 | Arabidopsis Argonaute4, Argonaute6 and Argonaute9 associated small RNAs |
1 | GSM415785 | Arabidopsis Argonaute4, Argonaute6 and Argonaute9 associated small RNAs |
1 | GSM415786 | Arabidopsis Argonaute4, Argonaute6 and Argonaute9 associated small RNAs |
1 | GSM415787 | Arabidopsis Argonaute4, Argonaute6 and Argonaute9 associated small RNAs |
1 | GSM415792 | Arabidopsis Argonaute4, Argonaute6 and Argonaute9 associated small RNAs |
1 | GSM415797 | Arabidopsis Argonaute4, Argonaute6 and Argonaute9 associated small RNAs |
1 | GSM415798 | Arabidopsis Argonaute4, Argonaute6 and Argonaute9 associated small RNAs |
1 | GSM415799 | Arabidopsis Argonaute4, Argonaute6 and Argonaute9 associated small RNAs |
1 | GSM442935 | Uncovering small RNA-mediated responses to phosphate-deficiency in Arabidopsis by deep sequencing |
1 | GSM456944 | Deep sequencing of small RNAs in the trasngenic wild type plant and the IWR1-type transcription factor mutant, dms4 |
1 | GSM456945 | Deep sequencing of small RNAs in the trasngenic wild type plant and the IWR1-type transcription factor mutant, dms4 |
1 | GSM491567 | Genome-wide analysis of siRNA accumulation in Arabidopsis treated with bacteria |
1 | GSM491570 | Genome-wide analysis of siRNA accumulation in Arabidopsis treated with bacteria |
1 | GSM491571 | Genome-wide analysis of siRNA accumulation in Arabidopsis treated with bacteria |
1 | GSM491573 | Genome-wide analysis of siRNA accumulation in Arabidopsis treated with bacteria |
1 | GSM491578 | Genome-wide analysis of siRNA accumulation in Arabidopsis treated with bacteria |
1 | GSM506657 | Accumulation of TuMV-derived siRNAs in aerial parts of Arabidopsis thaliana plants at 7 and 10 dpi |
1 | GSM506669 | Accumulation of TuMV-derived siRNAs in aerial parts of Arabidopsis thaliana plants at 7 and 10 dpi |
1 | GSM506672 | Accumulation of TuMV-derived siRNAs in aerial parts of Arabidopsis thaliana plants at 7 and 10 dpi |
1 | GSM506673 | Accumulation of TuMV-derived siRNAs in aerial parts of Arabidopsis thaliana plants at 7 and 10 dpi |
1 | GSM506674 | Accumulation of TuMV-derived siRNAs in aerial parts of Arabidopsis thaliana plants at 7 and 10 dpi |
1 | GSM512703 | Genome-wide maps of AGO1-bound small RNA in Arabidopsis leaves |
1 | GSM518432 | MIRNA Gene Evolution in Arabidopsis lyrata and Arabidopsis thaliana |
1 | GSM554062 | Global identification of Arabidopsis thaliana ARGONAUTE1-associated small RNA. |
1 | GSM575247 | Genome-wide double-stranded RNA sequencing reveals the functional significance of base-paired RNAs in Arabidopsis |
1 | GSM605659 | Homology-guided Assembly of the Genomes of the Four Diverse Accessions Ler, C24, Bur-0 and Kro-0 |
1 | GSM605660 | Homology-guided Assembly of the Genomes of the Four Diverse Accessions Ler, C24, Bur-0 and Kro-0 |
1 | GSM707680 | Characterization of AGO1-/AGO4-associated smRNAs |
1 | GSM707682 | Characterization of AGO1-/AGO4-associated smRNAs |
1 | GSM707687 | Characterization of AGO1-/AGO4-associated smRNAs |