GGUAGCCAAGGAUGACUUGCCUG
Count | Sample ID | Experiment title |
---|---|---|
26 | GSM118374 | High-throughput sequencing of small RNAs from Arabidopsis thaliana |
5 | GSM118373 | High-throughput sequencing of small RNAs from Arabidopsis thaliana |
4 | GSM284747 | A link between RNA metabolism and silencing affecting Arabidopsis development |
4 | GSM707680 | Characterization of AGO1-/AGO4-associated smRNAs |
2 | GSM118372 | High-throughput sequencing of small RNAs from Arabidopsis thaliana |
2 | GSM442933 | Uncovering small RNA-mediated responses to phosphate-deficiency in Arabidopsis by deep sequencing |
2 | GSM506664 | Accumulation of TuMV-derived siRNAs in aerial parts of Arabidopsis thaliana plants at 7 and 10 dpi |
2 | GSM575246 | Genome-wide double-stranded RNA sequencing reveals the functional significance of base-paired RNAs in Arabidopsis |
2 | GSM707681 | Characterization of AGO1-/AGO4-associated smRNAs |
1 | GSM121453 | Small RNA identification in Arabidopsis thaliana using 454 data |
1 | GSM154377 | Arabidopsis thaliana small RNAs sequences identified using high-throughput 454 sequencing technology |
1 | GSM442935 | Uncovering small RNA-mediated responses to phosphate-deficiency in Arabidopsis by deep sequencing |
1 | GSM456944 | Deep sequencing of small RNAs in the trasngenic wild type plant and the IWR1-type transcription factor mutant, dms4 |
1 | GSM456945 | Deep sequencing of small RNAs in the trasngenic wild type plant and the IWR1-type transcription factor mutant, dms4 |
1 | GSM491570 | Genome-wide analysis of siRNA accumulation in Arabidopsis treated with bacteria |
1 | GSM491574 | Genome-wide analysis of siRNA accumulation in Arabidopsis treated with bacteria |
1 | GSM491576 | Genome-wide analysis of siRNA accumulation in Arabidopsis treated with bacteria |
1 | GSM506657 | Accumulation of TuMV-derived siRNAs in aerial parts of Arabidopsis thaliana plants at 7 and 10 dpi |
1 | GSM506658 | Accumulation of TuMV-derived siRNAs in aerial parts of Arabidopsis thaliana plants at 7 and 10 dpi |
1 | GSM575247 | Genome-wide double-stranded RNA sequencing reveals the functional significance of base-paired RNAs in Arabidopsis |
1 | GSM707679 | Characterization of AGO1-/AGO4-associated smRNAs |