GGUAGCCAAGGAUGACUUGCCU
Count | Sample ID | Experiment title |
---|---|---|
10 | GSM118374 | High-throughput sequencing of small RNAs from Arabidopsis thaliana |
8 | GSM707680 | Characterization of AGO1-/AGO4-associated smRNAs |
4 | GSM366866 | Computational and Analytical Framework for Small RNA Profiling by High-Throughput Sequencing (reproducibility) |
4 | GSM442933 | Uncovering small RNA-mediated responses to phosphate-deficiency in Arabidopsis by deep sequencing |
3 | GSM707678 | Characterization of AGO1-/AGO4-associated smRNAs |
3 | GSM707679 | Characterization of AGO1-/AGO4-associated smRNAs |
3 | GSM707681 | Characterization of AGO1-/AGO4-associated smRNAs |
2 | GSM506658 | Accumulation of TuMV-derived siRNAs in aerial parts of Arabidopsis thaliana plants at 7 and 10 dpi |
2 | GSM506666 | Accumulation of TuMV-derived siRNAs in aerial parts of Arabidopsis thaliana plants at 7 and 10 dpi |
2 | GSM506687 | Accumulation of TuMV-derived siRNAs in aerial parts of Arabidopsis thaliana plants at 7 and 10 dpi |
1 | GSM121453 | Small RNA identification in Arabidopsis thaliana using 454 data |
1 | GSM387521 | Small RNAs serve as a genetic buffer against genomic shock in Arabidopsis interspecific hybrids and allopolyploids |
1 | GSM415783 | Arabidopsis Argonaute4, Argonaute6 and Argonaute9 associated small RNAs |
1 | GSM442932 | Uncovering small RNA-mediated responses to phosphate-deficiency in Arabidopsis by deep sequencing |
1 | GSM491567 | Genome-wide analysis of siRNA accumulation in Arabidopsis treated with bacteria |
1 | GSM491569 | Genome-wide analysis of siRNA accumulation in Arabidopsis treated with bacteria |
1 | GSM491571 | Genome-wide analysis of siRNA accumulation in Arabidopsis treated with bacteria |
1 | GSM491576 | Genome-wide analysis of siRNA accumulation in Arabidopsis treated with bacteria |
1 | GSM506680 | Accumulation of TuMV-derived siRNAs in aerial parts of Arabidopsis thaliana plants at 7 and 10 dpi |
1 | GSM506690 | Accumulation of TuMV-derived siRNAs in aerial parts of Arabidopsis thaliana plants at 7 and 10 dpi |