AGCCAAGGAUGACUUGCCUG
Count | Sample ID | Experiment title |
---|---|---|
20 | GSM491576 | Genome-wide analysis of siRNA accumulation in Arabidopsis treated with bacteria |
11 | GSM491570 | Genome-wide analysis of siRNA accumulation in Arabidopsis treated with bacteria |
9 | GSM491571 | Genome-wide analysis of siRNA accumulation in Arabidopsis treated with bacteria |
8 | GSM154377 | Arabidopsis thaliana small RNAs sequences identified using high-throughput 454 sequencing technology |
8 | GSM491577 | Genome-wide analysis of siRNA accumulation in Arabidopsis treated with bacteria |
4 | GSM575246 | Genome-wide double-stranded RNA sequencing reveals the functional significance of base-paired RNAs in Arabidopsis |
4 | GSM707684 | Characterization of AGO1-/AGO4-associated smRNAs |
3 | GSM707685 | Characterization of AGO1-/AGO4-associated smRNAs |
2 | GSM121453 | Small RNA identification in Arabidopsis thaliana using 454 data |
2 | GSM121454 | Small RNA identification in Arabidopsis thaliana using 454 data |
2 | GSM707683 | Characterization of AGO1-/AGO4-associated smRNAs |
2 | GSM707691 | Characterization of AGO1-/AGO4-associated smRNAs |
1 | GSM118372 | High-throughput sequencing of small RNAs from Arabidopsis thaliana |
1 | GSM118374 | High-throughput sequencing of small RNAs from Arabidopsis thaliana |
1 | GSM149079 | Small RNAs in Arabidopsis thaliana and its RISC complexes |
1 | GSM415783 | Arabidopsis Argonaute4, Argonaute6 and Argonaute9 associated small RNAs |
1 | GSM415786 | Arabidopsis Argonaute4, Argonaute6 and Argonaute9 associated small RNAs |
1 | GSM456944 | Deep sequencing of small RNAs in the trasngenic wild type plant and the IWR1-type transcription factor mutant, dms4 |
1 | GSM456945 | Deep sequencing of small RNAs in the trasngenic wild type plant and the IWR1-type transcription factor mutant, dms4 |
1 | GSM491569 | Genome-wide analysis of siRNA accumulation in Arabidopsis treated with bacteria |
1 | GSM506691 | Accumulation of TuMV-derived siRNAs in aerial parts of Arabidopsis thaliana plants at 7 and 10 dpi |
1 | GSM707679 | Characterization of AGO1-/AGO4-associated smRNAs |
1 | GSM707682 | Characterization of AGO1-/AGO4-associated smRNAs |