Sequence

CUCGGACCAGGCUUCAUUCCCCC

Expression details
CountSample IDExperiment title
203GSM442933Uncovering small RNA-mediated responses to phosphate-deficiency in Arabidopsis by deep sequencing
166GSM442932Uncovering small RNA-mediated responses to phosphate-deficiency in Arabidopsis by deep sequencing
18GSM442935Uncovering small RNA-mediated responses to phosphate-deficiency in Arabidopsis by deep sequencing
15GSM442934Uncovering small RNA-mediated responses to phosphate-deficiency in Arabidopsis by deep sequencing
1GSM518448small RNAs sequences from grafted Arabidopsis thaliana and Nicotiana benthamiana tissues
1GSM707685Characterization of AGO1-/AGO4-associated smRNAs
1GSM707690Characterization of AGO1-/AGO4-associated smRNAs