GCGGUUCAUCGAUCUCUUCCU
| Count | Sample ID | Experiment title |
|---|---|---|
| 8 | GSM707682 | Characterization of AGO1-/AGO4-associated smRNAs |
| 5 | GSM707690 | Characterization of AGO1-/AGO4-associated smRNAs |
| 4 | GSM707685 | Characterization of AGO1-/AGO4-associated smRNAs |
| 3 | GSM707679 | Characterization of AGO1-/AGO4-associated smRNAs |
| 3 | GSM707691 | Characterization of AGO1-/AGO4-associated smRNAs |
| 2 | GSM707683 | Characterization of AGO1-/AGO4-associated smRNAs |
| 1 | GSM343002 | AGO1-dependent Small RNA in Arabidopsis Identified by High-Throughput Sequencing |
| 1 | GSM343005 | AGO1-dependent Small RNA in Arabidopsis Identified by High-Throughput Sequencing |
| 1 | GSM424848 | Low oxygen responsive small RNAs in Arabidopsis |
| 1 | GSM506656 | Accumulation of TuMV-derived siRNAs in aerial parts of Arabidopsis thaliana plants at 7 and 10 dpi |
| 1 | GSM506674 | Accumulation of TuMV-derived siRNAs in aerial parts of Arabidopsis thaliana plants at 7 and 10 dpi |
| 1 | GSM512702 | Genome-wide maps of AGO1-bound small RNA in Arabidopsis leaves |
| 1 | GSM575247 | Genome-wide double-stranded RNA sequencing reveals the functional significance of base-paired RNAs in Arabidopsis |
| 1 | GSM605661 | Homology-guided Assembly of the Genomes of the Four Diverse Accessions Ler, C24, Bur-0 and Kro-0 |
| 1 | GSM707678 | Characterization of AGO1-/AGO4-associated smRNAs |
| 1 | GSM707680 | Characterization of AGO1-/AGO4-associated smRNAs |