GUACAGAGUAGUCAAGCAUGAC
| Count | Sample ID | Experiment title |
|---|---|---|
| 19 | GSM707685 | Characterization of AGO1-/AGO4-associated smRNAs |
| 11 | GSM707691 | Characterization of AGO1-/AGO4-associated smRNAs |
| 9 | GSM707680 | Characterization of AGO1-/AGO4-associated smRNAs |
| 8 | GSM707681 | Characterization of AGO1-/AGO4-associated smRNAs |
| 4 | GSM707684 | Characterization of AGO1-/AGO4-associated smRNAs |
| 4 | GSM707690 | Characterization of AGO1-/AGO4-associated smRNAs |
| 2 | GSM707679 | Characterization of AGO1-/AGO4-associated smRNAs |
| 2 | GSM711892 | Small RNA sequencing in nine-day old nutrient-replete and N or P-limited wild type Arabidopsis seedlings |
| 1 | GSM253625 | Small RNAs in four Argonaute complexes in Arabidopsis |
| 1 | GSM277608 | Highly integrated single base resolution maps of the epigenome in Arabidopsis |
| 1 | GSM415783 | Arabidopsis Argonaute4, Argonaute6 and Argonaute9 associated small RNAs |
| 1 | GSM424847 | Low oxygen responsive small RNAs in Arabidopsis |
| 1 | GSM491570 | Genome-wide analysis of siRNA accumulation in Arabidopsis treated with bacteria |
| 1 | GSM491577 | Genome-wide analysis of siRNA accumulation in Arabidopsis treated with bacteria |
| 1 | GSM518443 | small RNAs sequences from grafted Arabidopsis thaliana and Nicotiana benthamiana tissues |
| 1 | GSM707682 | Characterization of AGO1-/AGO4-associated smRNAs |
| 1 | GSM707686 | Characterization of AGO1-/AGO4-associated smRNAs |