GCGUACAGAGUAGUCAAGCA
| Count | Sample ID | Experiment title |
|---|---|---|
| 3 | GSM442932 | Uncovering small RNA-mediated responses to phosphate-deficiency in Arabidopsis by deep sequencing |
| 2 | GSM277611 | Highly integrated single base resolution maps of the epigenome in Arabidopsis |
| 2 | GSM442933 | Uncovering small RNA-mediated responses to phosphate-deficiency in Arabidopsis by deep sequencing |
| 2 | GSM442935 | Uncovering small RNA-mediated responses to phosphate-deficiency in Arabidopsis by deep sequencing |
| 1 | GSM277610 | Highly integrated single base resolution maps of the epigenome in Arabidopsis |
| 1 | GSM415790 | Arabidopsis Argonaute4, Argonaute6 and Argonaute9 associated small RNAs |
| 1 | GSM424848 | Low oxygen responsive small RNAs in Arabidopsis |
| 1 | GSM491576 | Genome-wide analysis of siRNA accumulation in Arabidopsis treated with bacteria |
| 1 | GSM518431 | MIRNA Gene Evolution in Arabidopsis lyrata and Arabidopsis thaliana |
| 1 | GSM707691 | Characterization of AGO1-/AGO4-associated smRNAs |