CGUGCCUGGCUCCCUGUAUGC
| Count | Sample ID | Experiment title |
|---|---|---|
| 2 | GSM707681 | Characterization of AGO1-/AGO4-associated smRNAs |
| 2 | GSM707691 | Characterization of AGO1-/AGO4-associated smRNAs |
| 1 | GSM118374 | High-throughput sequencing of small RNAs from Arabidopsis thaliana |
| 1 | GSM253625 | Small RNAs in four Argonaute complexes in Arabidopsis |
| 1 | GSM366866 | Computational and Analytical Framework for Small RNA Profiling by High-Throughput Sequencing (reproducibility) |
| 1 | GSM424847 | Low oxygen responsive small RNAs in Arabidopsis |
| 1 | GSM506660 | Accumulation of TuMV-derived siRNAs in aerial parts of Arabidopsis thaliana plants at 7 and 10 dpi |
| 1 | GSM518452 | small RNAs sequences from grafted Arabidopsis thaliana and Nicotiana benthamiana tissues |